This project was prepared as part of a BioQUEST faculty development workshop entitled Chautauqua Short Course -- Bioinformatics Education Dissemination: Reaching Out, Connecting, and Knitting-together at Grand Valley State University in August 2006. The BioQUEST Curriculum Consortium is committed to the reform of undergraduate biology instruction through an emphasis on engaging students in realistic scientific practices. This approach is sometimes characterized as an inquiry driven approach and is captured in BioQUEST's three P's (problem-posing, problem-solving, and peer-persuasion). As part of this workshop groups of faculty were encouraged to initiate innovative curricular projects. We are sharing these works in progress in the hope that they will stimulate further exploration, collaboration and development. Please see the following links for additional information:

Upcoming events               BEDROCK Problem Spaces

 
RNA --> DNA --> RNA --> PROTEIN
 
 
Authors          Audiences          Overview           Materials          Resources           Future Directions
 

 


Authors


Antonieto Tan
Worcester State College


Marva Meadows
Butler University


Philip Villani
Butler University


Jill Rulfs
Worcester Polytechnic Institute


Michael Buckholt
Worcester Polytechnic Institute

 
   
 


Possible Audiences:

Students in High School and College Biology Immunology, Cell Biology, Virology, Bioinformatics, Genetics, Molecular Biology, Evolution  

 
 


Brief Overview:

This is an exercise with the following learning objectives: 1. DNA RNA and Viral Life Cycles 2. DNA codes for Proteins 3. Protein interactions with host cells 4. Infection 5. Replication leads to mutations Lesson includes a two set process. The first lesson through a step by step approach to introduce some tools used in bioinformatics. The second lesson is an open-ended inquiry type exercize whereby students use critical thinking to develop hypotheses and test them with tools from lesson one.  

 
   
 


Project Materials:

Computer with internet access Workbench (Web) Data set Brain Structure anaylsis program  

 
 


Resources and References:

Markham data Hemoglobin website Workbench website  

 
   
 


Future Directions:

1. entire project 2. construct data set 3. develop assessment tools 4. LOW viral load 200-500 copies per ml and HIGH is 5000-10000 and as high as 1 million. 5. >SSSDS GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATTATAATAGTACAGCTGAATAAATCTG TAGAAATTAATTGTACAAGACCCAACAACAATACAATAAGAAGGATACCTATAGGACCAGGGAGAGCATT TTATACAACAGGCAGAATAGGAGATATAAGGCCAGCACATTGTAACATTAGTAGAACAAAATGGAATAAC ACTTTAAAACTGATAGTTAACAAATTAAGAGAACAATTTAGGAATAAAACAATAATCTTTAATCAATCCT CA  

 
 


Attachments


- DataSheet-Proj2,Scenario22.xls
- Scenario_One_Subject 3.doc
- Project_Notes.doc
- Results_Alignment_Scenario_1.doc
- Scenario1_tree_results.doc
- DNA-RNA-Protein.ppt